Health & Medicine

Acute myeloid leukemia is propagated by a leukemic stem cell with lymphoid characteristics in a mouse model of CALM/AF10-positive leukemia

Published
of 15
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Description
Cancer Cell, Volume 10 Supplemental data Acute myeloid leukemia is propagated by a leukemic stem cell with lymphoid characteristics in a mouse model of CALM/AF10-positive leukemia Aniruddha J. Deshpande,
Transcript
Cancer Cell, Volume 10 Supplemental data Acute myeloid leukemia is propagated by a leukemic stem cell with lymphoid characteristics in a mouse model of CALM/AF10-positive leukemia Aniruddha J. Deshpande, Monica Cusan, Vijay P.S. Rawat, Hendrik Reuter, Alexandre Krause, Christiane Pott, Leticia Quintanilla-Martinez, Purvi Kakadia, Florian Kuchenbauer, Farid Ahmed, Eric Delabesse, Meinhard Hahn, Peter Lichter, Michael Kneba, Wolfgang Hiddemann, Elizabeth Macintyre, Cristina Mecucci, Wolf-Dieter Ludwig, R. Keith Humphries, Stefan K. Bohlander, Michaela Feuring-Buske, and Christian Buske Supplemental experimental procedures cdna constructs and retroviral vectors The 5.2 kb full length CALM/AF10 fusion gene initially cloned from the U937 monocytic cell line was sub-cloned by blunt end ligation into the HpaI (New England Biolabs) site in the multiple cloning site (MCS) of the modified murine stem cell virus (MSCV) 2.1 vector upstream of the internal ribosomal entry site (IRES) and the enhanced GFP fluorescent protein gene. As a control, the MSCV vector carrying only the IRES-enhanced GFP cassette was used. Southern and western blotting The number of provirus integrants was determined by EcoRI digestion, followed by Southern blot analysis using standard techniques (Buske et al., 2002). Protein expression from the CALM/AF10 plasmid was documented by Western blotting using standard procedures (Schessl et al., 2005). The blotted membrane was incubated overnight with goat polyclonal anti-calm antibodies (C18, C17 and S19, Santa Cruz Biotech, Germany) used at a concentration of 200ng/ml. The secondary antibody used was a horse radish peroxidase conjugated donkey anti-goat antibody (100ng/ml). Cell culture GP + E86 cells were grown in DMEM medium with 10% FBS and 1% Pen/Strep in a humidified incubator at 37 C and 5% CO 2. Primary murine bone marrow (BM) cells were plated in transplant medium consisting of DMEM supplemented with 15% FBS, 1% Pen/Strep, 6ng/ml IL3, 10ng/ml IL6 and 100ng/ml stem cell factor (BM cultivation medium) (Tebu-bio GmbH, Offenbach, Germany). IL-3 dependent cell populations from leukemic CALM/AF10 mice were cultured in vitro directly after sorting in DMEM 15% FBS supplemented with IL-3 (6 ng/ml). Single cell lines were generated by sorting these cells into 96-well plates using the BD FACS Vantage (BD Biosciences, San Jose, CA) in 200µl DMEM (50% FBS) and 6 ng/ml IL3. Single cell clones were expanded and used for assessment of seeding efficiency, differentiation capacity and DJ H rearrangements of the heavy chain of the IGH locus. Single B220 + /Mac1 - cells differentiating into functional Mac1 + /B220 - macrophages in IL3 supplemented medium were analysed for phagocytosis by incubating the cells with a suspension of S.cerevisiae AH109 for 1 2 h at 37 C in a ratio of 100 yeast cells per cell. Cytospin preparations of the cells were stained with a modified Wright-Giemsa (Merck KGaA, Darmstadt, Germany) staining protocol on glass slides. CFC assays Colony forming cell (CFC) assays from leukemic mice were performed by plating cells in methylcellulose based semi-solid medium supplemented with cytokines (Methocult M3434, StemCell Technologies, Vancouver). Sorted cells were plated onto methylcellulose dishes and scored for colony formation after 7-9 days. Assays for human AML CFCs were performed by plating cells from AML patient samples at 20,000 to 200,000 cells/ml in methylcellulose medium (MethoCult H4330, Stemcell Technologies, Canada) with 3 U/mL human erythropoietin (EPO; Stemcell), 10 ng/ml GM-CSF (Immunotools, Friesoythe, Germany), 10 ng/ml IL-3, (Immunotools) 50 ng/ml SF (Immunotools) and 50 ng/ml Flt-3 ligand (Immunotools). Cultures were scored after 14 days for the presence of clusters (4-20 cells) and colonies (more than 20 cells). Colonies arising days after incubation were picked and dissolved in TE, boiled at 94 C for 10 min and the supernatant was used for PCR of IGH DJ rearrangements using GeneScan as described. Individual colonies were photographed using a CCD camera at 100 X magnification (CoolSnap, Roper Scientific GmbH, Germany). Flow cytometry and histology Single cell suspensions of cells were immunostained with various fluorescence-conjugated antibodies as previously described (Schessl et al., 2005).Antibodies used for FACS were labelled with phycoerythrin for Gr-1, CD11b (Mac1), Sca1, Ter119, CD4, CD19, CD24, CD43, and allophycocyanin conjugated CD11b (Mac1), CD117 (c-kit), B220, and CD8 (BD Pharmingen, Heidelberg, Germany) and phycoerythrin conjugated AA4.1, FLT3 and IL7-R (Ebiosciences, San Diego, CA). Fluorescence was detected using a FACSCalibur flow cytometer and analysed using the CellQuest software (BD Biosciences). For histological analyses, sections of selected organs were prepared and stained at the Academic Pathology Laboratory, GSF, Munich, using standard protocols, as previously described (Schessl et al., 2005). All the tumors were histopathologically classified following the Bethesda proposals for classification on non-lymphoid and lymphoid hematopoietic neoplasms in mice (Kogan et al., 2002; Morse et al., 2002). PCR PCRs were performed to check the expression of various lineage specific transcripts in highly purified B220 + /Mac1 -, B220 + /Mac1 + and B220 - /Mac1 + cells. These subpopulations were highly purified from a cell population expanded from a single B220 + /Mac1 - cell, which was initially isolated from the bulk leukemic BM population of a diseased mouse. Sort purity of cells was analysed and determined to be over 98% in each case. PCR was performed for Aiolos, MCSF-R, GSCF-R, EBF, MPO, Pax5, PU.1, GATA2, and GATA3 using specific primers. The housekeeping gene HPRT was used to normalize input cdna. Initially, a test PCR with all cdnas employing 20, 25 and 30 cycles for HPRT was performed to avoid saturation related pseudo-normalization. Then, the PCRs were performed for each gene with 35 cycles at different conditions. The PCRs for the detection of D-J rearrangements and those for V-DJ rearrangements at the IGH locus as well as for the rearrangements of the TCRγ and TCRδ were performed as described previously (Capone et al., 1998; Fuxa et al., 2004; Martensson et al., 1997). Oligonucleotide sequences for all primers are described in Table S5. For analysis of IGH DH-JH or TCR rearrangements in patients with CALM/AF10 positive AML 100 ng of DNA isolated from leukemic bone marrow ( 80% myeloid blasts) was analysed in duplicates for each target using multiplex primer sets: IGH DH-JH, TCRβ (VB-JB and DB-JB), TCRγ, TCRδ, according to the BIOMED-2 protocol as previously pulished (van Dongen et al., 2003). Clonality analyses by genescanning and sequence analyses were performed on an ABI PRISM 377 automated sequencer (Applied Biosystems, Foster City, CA, USA). Sequences were obtained by using the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems). LM-PCR Integrated LTR and flanking genomic sequences were amplified and then isolated using a modification of the bubble LM-PCR strategy (Imren et al., 2004; Schessl et al., 2005). 40 pg of genomic DNA from bulk leukemic bone marrow samples were digested with Pst I (New England Biolabs), and the fragments were then ligated overnight at room temperature to a double stranded bubble linker obtained by annealing the two oligonucleotides (5 - CTCTCCCTTCTCGAATCGTA ACCGTTCGTACGAGAATCGCTGTCCTCTCCTTG-3 and 5 - ANTCAAGGAGAGGACGCTGTCTGTCGAAGGTAAGGAACGGACGAGAGA AGGGAGAG-3 ) prior to performing a first PCR (PCR-A) on 10 µl (one-tenth) of the ligation product using a linker-specific Vectorette primer (5 -CGAATCGTAACCGTTCGTACGAGAATCG CT- 3 ) and a LTR-specific primer (LTR-A: 5'- CAACACACACATTGAAGCACTCAAGGCAAG-3 ) and under the following conditions: one cycle of 94 C for 2 minutes, 20 cycles of 94 C for 30 seconds and 65 C for 1 minute, and one cycle of 72 C for 2 minutes. The bubble linker contains a 30-nucleotide non-homologous sequence in the middle region that prevents binding of the linker primer in the absence of minus strand generated by the LTR-specific primer. A 1-µl aliquot of the PCR-A reaction (one-fifteenth) was then used as a template for a second nested PCR (PCR-B) using an internal LTR-specific primer (LTR-B: 5 -GAGAGCTCCCAGGCTCAGA TCTGGTCTAAC-3 ) and the same linker-specific Vectorette primer as was used in PCR-A with the following conditions: one cycle of 94 C for 2 minutes, 30 cycles of 94 C for 60 seconds and 72 C for 1 minute, and one cycle of 72 C for 2 minutes. 10 µl (one-half) of the final PCR-B product were electrophoresed using 2% agarose TAE gel. Individual bands were excised and purified using the Amersham Gel Band and PCR purification kit (Amersham) for sequencing. Different types of marked fragments were obtained. These fragments were cloned in the pgem-t easy TA cloning vector (Promega GmbH, Mannheim) and sequenced using the nested primer B. BLAST searches were performed using the University of California Santa Cruz (UCSC) genome project website (http://genome.ucsc.edu) to identify the genomic location of the flanking sequences. Identified genomic loci were screened using the retroviral tagged cancer genes database (RTCGD mm7) custom track on the UCSC Genome browser (August 2005 assembly). Microarray RNA from B220 + /Mac -, B220 + /Mac1 + and B220 - /Mac1 + sorted cells was isolated with the RNeasy micro kit according to manufactures instructions (Qiagen), amplified and labelled as previously described (Schlingemann et al., 2005). Samples were hybridised to ArrayTAG (LION Bioscience) containing 20,172 PCR amplified sequenceverified gene-specific DNA fragments. The microarray processing and hybridisation procedures were the same as described (Wrobel et al., 2003). After hybridisation and stringent washing, fluorescence intensity images were acquired using a GenePix 4000 A (Axon Instruments, Foster City, California) dual laser scanner and analysed with the GenePix Pro 3.0 imaging software. For each competitive hybridisation colour switch experiments in which e. g. DNA of B220 and Mac1 sorted cells were labelled vice versa with Cy3-dUTP and Cy5-dUTP, respectively. The results of the corresponding colour-switched experiments were averaged. Data sets were ranked according to spot homogeneity, spot intensity and the standard deviation of logarithmic ratios of replicate spots. Data for spots not recognized by the GenePix software and data points that ranked among the lower 20%, based on the criteria described, were excluded from further analysis. Fluorescence ratios (Cy5/Cy3) of each hybridisation were normalized by variance stabilization (Huber et al., 2002). EASE analysis was performed with expression ratios of lnx 0.6 or lnx 0.6. Significantly overrepresented gene categories and their superior gene ontology (GO) systems are listed (EASE-score 0.05). Percentage is calculated from the amount of significantly up- or downregulated transcripts from a given gene category in relation to the whole amount of cdnas spotted on the chip belonging to this gene category (Hosack et al., 2003). Statistical analysis Data were evaluated by using the t test for dependent or independent samples (Microsoft EXCEL). Differences with P values 0.05 were considered statistically significant. For calculations of frequency of leukemia propagating cells, the L-Calc software was used (StemSoft Software Inc.). Supplemental references Akagi, K., Suzuki, T., Stephens, R. M., Jenkins, N. A., and Copeland, N. G. (2004). RTCGD: retroviral tagged cancer gene database. Nucleic Acids Res 32, D Buske, C., Feuring-Buske, M., Abramovich, C., Spiekermann, K., Eaves, C. J., Coulombel, L., Sauvageau, G., Hogge, D. E., and Humphries, R. K. (2002). Deregulated expression of HOXB4 enhances the primitive growth activity of human hematopoietic cells. Blood 100, Capone, M., Hockett, R. D., Jr., and Zlotnik, A. (1998). Kinetics of T cell receptor beta, gamma, and delta rearrangements during adult thymic development: T cell receptor rearrangements are present in CD44(+)CD25(+) Pro-T thymocytes. Proc Natl Acad Sci U S A 95, Fuxa, M., Skok, J., Souabni, A., Salvagiotto, G., Roldan, E., and Busslinger, M. (2004). Pax5 induces V-to-DJ rearrangements and locus contraction of the immunoglobulin heavy-chain gene. Genes Dev 18, Hosack, D. A., Dennis, G., Jr., Sherman, B. T., Lane, H. C., and Lempicki, R. A. (2003). Identifying biological themes within lists of genes with EASE. Genome Biol 4, R70. Huber, W., von Heydebreck, A., Sultmann, H., Poustka, A., and Vingron, M. (2002). Variance stabilization applied to microarray data calibration and to the quantification of differential expression. Bioinformatics 18 Suppl 1, S Imren, S., Fabry, M. E., Westerman, K. A., Pawliuk, R., Tang, P., Rosten, P. M., Nagel, R. L., Leboulch, P., Eaves, C. J., and Humphries, R. K. (2004). High-level beta-globin expression and preferred intragenic integration after lentiviral transduction of human cord blood stem cells. J Clin Invest 114, Kogan, S. C., Ward, J. M., Anver, M. R., Berman, J. J., Brayton, C., Cardiff, R. D., Carter, J. S., de Coronado, S., Downing, J. R., Fredrickson, T. N., et al. (2002). Bethesda proposals for classification of nonlymphoid hematopoietic neoplasms in mice. Blood 100, Martensson, I. L., Melchers, F., and Winkler, T. H. (1997). A transgenic marker for mouse B lymphoid precursors. J Exp Med 185, Morse, H. C., 3rd, Anver, M. R., Fredrickson, T. N., Haines, D. C., Harris, A. W., Harris, N. L., Jaffe, E. S., Kogan, S. C., MacLennan, I. C., Pattengale, P. K., and Ward, J. M. (2002). Bethesda proposals for classification of lymphoid neoplasms in mice. Blood 100, Schessl, C., Rawat, V. P., Cusan, M., Deshpande, A., Kohl, T. M., Rosten, P. M., Spiekermann, K., Humphries, R. K., Schnittger, S., Kern, W., et al. (2005). The AML1-ETO fusion gene and the FLT3 length mutation collaborate in inducing acute leukemia in mice. J Clin Invest 115, Schlingemann, J., Thuerigen, O., Ittrich, C., Toedt, G., Kramer, H., Hahn, M., and Lichter, P. (2005). Effective transcriptome amplification for expression profiling on sense-oriented oligonucleotide microarrays. Nucleic Acids Res 33, e29. van Dongen, J. J., Langerak, A. W., Bruggemann, M., Evans, P. A., Hummel, M., Lavender, F. L., Delabesse, E., Davi, F., Schuuring, E., Garcia-Sanz, R., et al. (2003). Design and standardization of PCR primers and protocols for detection of clonal immunoglobulin and T-cell receptor gene recombinations in suspect lymphoproliferations: report of the BIOMED-2 Concerted Action BMH4-CT Leukemia 17, Wrobel, G., Schlingemann, J., Hummerich, L., Kramer, H., Lichter, P., and Hahn, M. (2003). Optimization of highdensity cdna-microarray protocols by 'design of experiments'. Nucleic Acids Res 31, e67. Figure S1. CALM/AF10 cloning and expression A: Retroviral vectors used to express CALM/AF10 and GFP in murine BM. LTR = long terminal repeats; IRES = internal ribosomal entry site; GFP = green fluorescent protein. B: Western blot analysis of cellular extracts from 293-T transfected with CALM/AF10 or GP + E86 cells stably transduced with the CALM/AF10 fusion gene (which were used for bone marrow transduction experiments) and from non-transfected 293-T cells. The molecular mass is indicated. The blot shows the two isoforms of endogenous CALM. C: Flow cytometric analysis of engraftment in the bone marrow of GFP expressing cells in a representative CALM/AF10 mouse 8 weeks after injection of 2 x 10 5 GFP positive CALM/AF10 transduced cells and the same number of non-transduced helper cells. A B C Figure S2. The CALM/AF10 induced disease is oligoclonal Southern Blot analyses of genomic DNA from (A) bone marrow (BM), spleen and peripheral blood (PB) and bone marrow and spleen of two representative primary leukemic CALM/AF10 mice and (B) from BM and spleen (SP) of a primary C/A mouse and its secondary recipient. Genomic DNA was digested with EcoRI to determine the number of proviral integrations. Signals with different intensities, indicating the presence of different leukemic clones, are marked. A B Figure S3. Frequency and immunophenotype of the leukemic B220 - /MM - population and phenotype of leukemias in primary mice transplanted with B220-depleted bone marrow A: Dot plot of bone marrow cells from a representative leukemic mouse co-stained with APC-conjugated B220 and PE-conjugated Gr1 and Mac1 antibodies (in contrast to the dot plots showing cells co-stained with B220 and Mac1 only in Fig.2A, 2D and 3A). It shows the percentage of the cells being negative for all three markers. The sort gate and the proportion of the different subpopulations is shown. In lower panels cells were co-stained with APCconjugated B220/Gr1/Mac1 antibodies and PE conjugated Sca1 and c-kit antibodies, respectively. The proportion of Sca1 and c-kit positive cells within the B220 - /Gr1 - /Mac1 - population is indicated. B: Morphological and flow cytometric demonstration of acute myeloid leukemia in the bone marrow of mice injected with B220 - IGH germline progenitors. Scale bar: 10µm. Figure S4. Immunophenotypic analysis of additional B lymphoid cell markers Staining for various B cell lineage associated surface markers on leukemic B220 + /Mac1 - purified cells for CD23 and sigm (A) and non-sorted leukemic cells propagated in vitro for λ5, BP1, CD21 and Igβ (B). C: RT-PCR analysis of additional lineage associated genes. B220 + /MM -, B220 + /MM + and B220 - /MM + cells clonally generated from a single B220 + /Mac1 - cell were analysed for the expression of lymphoid associated genes as indicated. Figure S5. Synopsis of the characteristics of transformed CALM/AF10 positive B220 + /MM - cells The B220 + /MM - cells expressed B220/EBF/CD24/AA4.1/CD43/Rag2/VpreB and MPO (orange box) and did not show the expression of various early and late surface markers analyzed by flow cytometry (green box) or transcripts as analyzed by RT-PCR (red box). Table S1. Identity of retroviral integration sites in diseased mice No. Gene Description Genomic location Mouse no. 1* Intron 20 of jouberin (Ahi1) SH3 domain containing protein 10 A3 1 2* Intron 2 of Sgk3 Serine/threonine 1A2 6 Protein kinase 3 30kb 3 of M22Rik - 12E 6 4* Intron 5 of AK Weakly similar to Keratin 8 15F2 6 5* Intron 3 of RAD51L1 DNA break repair associated protein 12C3 6 6 Intron 1 of AK Carboxyl-terminal PDZ ligand of 1H3 6 neuronal nitric oxide synthase homolog 7 ~12kb 5 of PNRC1-4A5 6 8* Intron 10 of SUSD1 Sushi domain containing protein 4B3 6 9* Intron 1 of AK Unknown 17B Intergenic region - 7B3 6 2kb 5 of AK Intergenic region 7 D2 7 (11kb 5 of Furin) - 12 Intron 2 of Bre Brain and reproductive organs specific 5 B1 8 protein 13* Intergenic region - 15 F2 8 (4.5 kb 3 of Acvrl1) 14 Intergenic region - 1 E3-E4 8 15* Intron 2 of H14Rik Hypothetical protein X A1.1 9 LOC Intron 8 of Ubxd5 Ubx domain containing protein 4 D Intron1 of Gene Hypothetical protein 13 C F10Rik Q8C8C0 18* Intergenic region (11 kb 5 of - 5 E4 9 Plac8) * Identified in or near regions (~50 kb) described as common integration sites (CIS) in the RTCGD database (http://rtcgd.ncifcrf.gov/) transposon tagged cancer gene from RTCGD (Akagi et al., 2004) Table S2. Occurrence of AML in secondary mice transplanted with leukemic bone marrow-derived subpopulations B220 + /Mac1 - B220 + /Mac1 + B220 - /Mac1 + Cell number No of mice injected No of leukemic mice Median Latency* No of mice injected No of leukemic mice Median Latency No of mice injected No of leukemic mice Median Latency n.a 0 0 n.a n.a n.a n.a n.a n.a 4 0 n.a n.a: not applicable (when no mice injected or all mice alive in the cohort) * median latency of leukemia in diseased mice Table S3. Engraftment and leukemogenic potential of B220 negative/myeloid marker negative or B220-positive/myeloid marker negative cells in transplanted mice No. Population injected Number of cells injected Engraftment at 6 weeks (% GFP + in BM) Leukemic engraftme
Search
Similar documents
View more...
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks